Query (optional)   in Class  

GrainGenes Probe Report: GPW4101

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW4101  [ Marker Report ]
Locus
Xgpw4101-4B
Xgpw4101-7B
General Remarks
Motif (TC)18
Type
PCR
SSR
PCR primers
Forward TCCTAGATGGAGGTCTTGGC
Forward TCCTAGATGGAGGTCTTGGC
Reverse TCCTCCTCCCCATTTTGAG
Reverse TCCTCCTCCCCATTTTGAG
SSR size
Expected 135
Amplification Conditions
Tm = 60C
Linkage Group
4B/7B
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09