Query (optional)   in Class  

GrainGenes Probe Report: GPW4143

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW4143  [ Marker Report ]
Locus
Xgpw4143-3B
General Remarks
Motif (TC)12
Type
PCR
SSR
PCR primers
Forward CCGACGACCCGTACAAAG
Forward CCGACGACCCGTACAAAG
Reverse AATATGGCACTACCCGTGGA
Reverse AATATGGCACTACCCGTGGA
SSR size
Expected 228
Amplification Conditions
Tm = 60C
Linkage Group
3B
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09