Query (optional)   in Class  

GrainGenes Probe Report: GPW4163

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW4163  [ Marker Report ]
Locus
Xgpw4163-3D
General Remarks
Motif (AGA)4(TC)21
Type
PCR
SSR
PCR primers
Forward TGGCAATGGAGGTAATGACA
Forward TGGCAATGGAGGTAATGACA
Reverse TGGTGCCCTAAAATTGGTTT
Reverse TGGTGCCCTAAAATTGGTTT
SSR size
Expected 389
Amplification Conditions
Tm = 60C
Linkage Group
3D
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09