Query (optional)   in Class  

GrainGenes Probe Report: GPW4165

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW4165  [ Marker Report ]
Locus
Xgpw4165-2B
Sr47
General Remarks
Motif (TC)18(CA)16
Type
PCR
SSR
PCR primers
Forward GGATTCCAACAGAGCACCTT
Forward GGATTCCAACAGAGCACCTT
Reverse AAGCAAGAAACAATGGGCAC
Reverse AAGCAAGAAACAATGGGCAC
SSR size
Expected 133
Amplification Conditions
Tm = 60C
Linkage Group
2B
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09