Query (optional)   in Class  

GrainGenes Probe Report: GPW4307

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW4307  [ Marker Report ]
Locus
Xgpw4307-2B
Xgpw4307-2D
General Remarks
Motif (GT)12
Type
PCR
SSR
PCR primers
Forward GGCAAGGATACACGTCAGGT
Forward GGCAAGGATACACGTCAGGT
Reverse TGACATAATAAACTCCCCCAGG
Reverse TGACATAATAAACTCCCCCAGG
SSR size
Expected 333
Amplification Conditions
Tm = 60C
Linkage Group
2D/2B
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09