Query (optional)   in Class  

GrainGenes Probe Report: GPW4315

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW4315  [ Marker Report ]
Locus
[ Hide all but 1 of 7 ]
Xgpw4315-4A
Xgpw4315-4B
Xgpw4315-4D
gpw4315.1
gpw4315.2
gpw4315-4A
gpw4315-4D
General Remarks
Motif (GT)23(GA)13
Type
PCR
SSR
PCR primers
Forward TCGGGGACAGAGGGTTCT
Forward TCGGGGACAGAGGGTTCT
Reverse ACGTGCCAGGGAGGTATCTT
Reverse ACGTGCCAGGGAGGTATCTT
SSR size
Expected 150
Amplification Conditions
Tm = 60C
Linkage Group
4A/4D/4B
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09