Query (optional)   in Class  

GrainGenes Probe Report: GPW4331

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW4331  [ Marker Report ]
Locus
Xgpw4331-1A
Xgpw4331-1B
General Remarks
Motif (TC)13
Type
PCR
SSR
PCR primers
Forward AACCATGAGCACGGATTCTC
Forward AACCATGAGCACGGATTCTC
Reverse AAAGATCGCACCTGCACTG
Reverse AAAGATCGCACCTGCACTG
SSR size
Expected 176
Amplification Conditions
Tm = 60C
Linkage Group
1B/1A
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09