Query (optional)   in Class  

GrainGenes Probe Report: GPW4474

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW4474  [ Marker Report ]
Locus
Xgpw4474-2A
[ Show all 7 ]
General Remarks
Motif (TC)21(TG)22
Type
PCR
SSR
PCR primers
Forward AGATGCGCCGTCTACTGG
Forward AGATGCGCCGTCTACTGG
Reverse CAGATAACGCCGTCCAATTT
Reverse CAGATAACGCCGTCCAATTT
SSR size
Expected 186
Amplification Conditions
Tm = 60C
Linkage Group
2A/2D/2B
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09