Query (optional)   in Class  

GrainGenes Probe Report: GPW5001

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW5001  [ Marker Report ]
Locus
Xgpw5001-3D
General Remarks
Motif (GA)18
Type
PCR
SSR
PCR primers
Forward TCTCCATTTACAGCAGCGAA
Reverse ATCTGAACCTCCGTGGACTG
SSR size
Expected 219
Amplification Conditions
Tm = 60C
Linkage Group
3D
Source Species
Aegilops tauschii
Data Source
Sourdille, Pierre2009.09