Query (optional)   in Class  

GrainGenes Probe Report: GPW5094

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW5094  [ Marker Report ]
Locus
Xgpw5094-3D
Xgpw5094-4A
General Remarks
Motif (GA)18
Type
PCR
SSR
PCR primers
Forward GACGATCAACAGCGAGTCAA
Forward GACGATCAACAGCGAGTCAA
Reverse TTACAATCTCACCCTGGCAA
Reverse TTACAATCTCACCCTGGCAA
SSR size
Expected 242
Amplification Conditions
Tm = 60C
Linkage Group
3D/4A
Source Species
Aegilops tauschii
Data Source
Sourdille, Pierre2009.09