Query (optional)   in Class  

GrainGenes Probe Report: GPW5129

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW5129  [ Marker Report ]
Locus
Xgpw5129-5D
General Remarks
Motif (AC)17.5
Type
PCR
SSR
PCR primers
Forward GGTGAATGTTGTAGTGGACAGA
Reverse GCATAGTCTCCGCATTTGGT
SSR size
Expected 153
Amplification Conditions
Tm = 60C
Linkage Group
5D
Source Species
Aegilops tauschii
Data Source
Sourdille, Pierre2009.09