Query (optional)   in Class  

GrainGenes Probe Report: GPW5133

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW5133  [ Marker Report ]
Locus
Xgpw5133-4D
gpw5133
gpw5133-4A
General Remarks
Motif (GA)17.5
Type
PCR
SSR
PCR primers
Forward GATTTCGTGCGGTTTCTGTT
Reverse ATTTATTTCGTTGCACCCCA
SSR size
Expected 160
Amplification Conditions
Tm = 60C
Linkage Group
4D
Source Species
Aegilops tauschii
Data Source
Sourdille, Pierre2009.09