Query (optional)   in Class  

GrainGenes Probe Report: GPW5179

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW5179  [ Marker Report ]
Locus
Xgpw5179-6D
General Remarks
Motif (AG)36.5
Type
PCR
SSR
PCR primers
Forward CCATTCCGCAAATGATGATA
Reverse GCGTATTCGGGTTGTTCATT
SSR size
Expected 253
Amplification Conditions
Tm = 60C
Linkage Group
6D
Source Species
Aegilops tauschii
Data Source
Sourdille, Pierre2009.09