Query (optional)   in Class  

GrainGenes Probe Report: GPW5188

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW5188  [ Marker Report ]
Locus
Xgpw5188-1A
Xgpw5188-3A
General Remarks
Motif (GA)43
Type
PCR
SSR
PCR primers
Forward TTTTCTGGTGTCTTTTGCTGG
Reverse GATTTGTTGATGCGTGCG
SSR size
Expected 276
Amplification Conditions
Tm = 60C
Linkage Group
3A/1A
Source Species
Aegilops tauschii
Data Source
Sourdille, Pierre2009.09