Query (optional)   in Class  

GrainGenes Probe Report: GPW5257

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW5257  [ Marker Report ]
Locus
Xgpw5257-2A
Xgpw5257-3D
Xgpw5257-5B
General Remarks
Motif (TG)14
Type
PCR
SSR
PCR primers
Forward TAAATGCCAACATCAAACAAGG
Forward TAAATGCCAACATCAAACAAGG
Reverse TAAGTGAGGAATTGTTCTCCCA
Reverse TAAGTGAGGAATTGTTCTCCCA
SSR size
Expected 193
Amplification Conditions
Tm = 60C
Linkage Group
5B/3D/2A
Source Species
Aegilops tauschii
Data Source
Sourdille, Pierre2009.09