Query (optional)   in Class  

GrainGenes Probe Report: GPW7002

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW7002
General Remarks
Motif (GCA)7
Type
PCR
SSR
PCR primers
Forward GGCAGCAACAGCAACAACTA
Reverse TTTGCAGAGTGGGTTCACAG
Amplification Conditions
Tm = 60C
Linkage Group
6BL/6A/6B
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09