Query (optional)   in Class  

GrainGenes Probe Report: GPW7006

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW7006  [ Marker Report ]
Locus
Xgpw7006-1A
General Remarks
Motif (AG)14
Type
PCR
SSR
PCR primers
Forward TGAATTGCAGGAGTGGCG
Reverse CAAACAAGGAGACGGTGAGG
Amplification Conditions
Tm = 60C
Linkage Group
1A
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09