Query (optional)   in Class  

GrainGenes Probe Report: GPW7007

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW7007  [ Marker Report ]
Locus
Xgpw7007-5A
gpw7007
General Remarks
Motif (GA)10
Type
PCR
SSR
PCR primers
Forward AGGAGAGCGGCAAGGACTAC
Reverse GAGAATCACAGGAAGGCACG
Amplification Conditions
Tm = 60C
Linkage Group
5A
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09