Query (optional)   in Class  

GrainGenes Probe Report: GPW7038

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW7038
General Remarks
Motif (TG)14
Type
PCR
SSR
PCR primers
Forward TGGGACCATGTTACTGAAGC
Reverse GACTAGGCGCACTTGATTTG
Amplification Conditions
Tm = 60C
Linkage Group
3BL/3AL
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09