Query (optional)   in Class  

GrainGenes Probe Report: GPW7046

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW7046
General Remarks
Motif (CGC)8
Type
PCR
SSR
PCR primers
Forward GAACCTCGTCTTCCTCCTCC
Reverse ATACCCCTTGGCCTCATCG
Amplification Conditions
Tm = 60C
Linkage Group
2AS or 4BS
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09