Query (optional)   in Class  

GrainGenes Probe Report: GPW7048

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW7048
General Remarks
Motif (CCA)7
Type
PCR
SSR
PCR primers
Forward AGGACACTCCAACCCCTACC
Reverse TGATGTCGGCAATCTCGG
Amplification Conditions
Tm = 60C
Linkage Group
4DS
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09