Query (optional)   in Class  

GrainGenes Probe Report: GPW7051

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW7051  [ Marker Report ]
Locus
Xgpw7051-4A
General Remarks
Motif (CAA)6
Type
PCR
SSR
PCR primers
Forward CATGCAACAACAATCCCAAC
Reverse TGTCAACTGCTCCTGCAACT
Amplification Conditions
Tm = 60C
Linkage Group
4A
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09