Query (optional)   in Class  

GrainGenes Probe Report: GPW7052

Probe
GPW7052  [ Marker Report ]
Locus
Xgpw7052-1A
General Remarks
Motif (GCA)6(CAA)6
Type
PCR
SSR
PCR primers
Forward ATTCGGCACCAGCATCTACT
Reverse GGTTTCGTACAACGGCACAT
Amplification Conditions
Tm = 60C
Linkage Group
1A
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09