Query (optional)   in Class  

GrainGenes Probe Report: GPW7059

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW7059  [ Marker Report ]
Locus
Xgpw7059-1B
General Remarks
Motif (GTT)7
Type
PCR
SSR
PCR primers
Forward AACACCAATGACCTGATCGC
Reverse TCCTCAACAGCTCCAGTGC
Amplification Conditions
Tm = 60C
Linkage Group
1B
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09