Query (optional)   in Class  

GrainGenes Probe Report: GPW7065

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW7065
General Remarks
Motif (AGG)6
Type
PCR
SSR
PCR primers
Forward ACACCAAGCTCTGCTCACCT
Reverse TTCTCGCCCTTCAAAGACAC
Amplification Conditions
Tm = 60C
Linkage Group
5BL
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09