Query (optional)   in Class  

GrainGenes Probe Report: GPW7066

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW7066  [ Marker Report ]
Locus
Xgpw7066-4A
Xgpw7066-5B
General Remarks
Motif (CTC)6
Type
PCR
SSR
PCR primers
Forward GATCGTAGCAAAATCCTCCA
Reverse ATGCCGACGTAGTGCTTGC
Amplification Conditions
Tm = 60C
Linkage Group
5B
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09