Query (optional)   in Class  

GrainGenes Probe Report: GPW7067

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW7067  [ Marker Report ]
Locus
Xgpw7067-6B
Xgpw7067-6D.1
Xgpw7067-6D.2
General Remarks
Motif (AG)9
Type
PCR
SSR
PCR primers
Forward CTCCATACCTCTCCCTTCGC
Reverse GATAGGCCACCCATTGTGAT
Amplification Conditions
Tm = 60C
Linkage Group
6B/6D
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09