Query (optional)   in Class  

GrainGenes Probe Report: GPW7070

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW7070  [ Marker Report ]
Locus
Xgpw7070-1A
Xgpw7070-1B
General Remarks
Motif (TTG)13
Type
PCR
SSR
PCR primers
Forward CCAATGACCTGATTTCCTCC
Reverse CATCGTGCATTCCATCATCA
Amplification Conditions
Tm = 60C
Linkage Group
1A/1B
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09