Query (optional)   in Class  

GrainGenes Probe Report: GPW7072

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW7072  [ Marker Report ]
Locus
Xgpw7072-1A
gpw7072
Reference
ReferenceNicot N et al. Study of simple sequence repeat (SSR) markers from wheat expressed sequence tags (ESTs) Theoretical and Applied Genetics 109:800-805.
General Remarks
Motif (GCA)6(CAA)6
Type
PCR
SSR
PCR primers
Forward 5' AATGCAGCGATGTCTTGCTA
Reverse 5' ACTGTTGGGGTTGTTGTTGC
Forward AATGCAGCGATGTCTTGCTA
Reverse ACTGTTGGGGTTGTTGTTGC
Amplification Conditions
Tm = 60C
Linkage Group
1A
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09