Query (optional)   in Class  

GrainGenes Probe Report: GPW7073

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW7073  [ Marker Report ]
Locus
Xgpw7073-6A
General Remarks
Motif (ACA)11
Type
PCR
SSR
PCR primers
Forward CAACCATTTCGACCACAACA
Reverse CTCAGGGATCTGCCATAGGT
Amplification Conditions
Tm = 60C
Linkage Group
6A
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09