Query (optional)   in Class  

GrainGenes Probe Report: GPW7079

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW7079  [ Marker Report ]
Locus
Xgpw7079-6D
gpw7079
Reference
ReferenceNicot N et al. Study of simple sequence repeat (SSR) markers from wheat expressed sequence tags (ESTs) Theoretical and Applied Genetics 109:800-805.
General Remarks
Motif (CAA)9
Type
PCR
SSR
PCR primers
Forward 5' AGCTGGTGCCATTGTGTTGT
Reverse 5' CCTGGCCTGATGGATATTGT
Forward AGCTGGTGCCATTGTGTTGT
Reverse CCTGGCCTGATGGATATTGT
Amplification Conditions
Tm = 60C
Linkage Group
6D
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09