Query (optional)   in Class  

GrainGenes Probe Report: GPW7080

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW7080  [ Marker Report ]
Locus
Xgpw7080-3A
Xgpw7080-3B
Xgpw7080-3D
gpw7080
gpw7080-3A
General Remarks
Motif (AT)16
Type
PCR
SSR
PCR primers
Forward ATGCCAACCAGACATCACAG
Reverse CAAAACCTACAGCTCCCTCG
Amplification Conditions
Tm = 60C
Linkage Group
3B/3D/3A
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09