Query (optional)   in Class  

GrainGenes Probe Report: GPW7084

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW7084
General Remarks
Motif (TGCG)5
Type
PCR
SSR
PCR primers
Forward GTTCGAGGGTAAGGGGAAGT
Reverse GCTCATCGTCTTGGCGTTC
Amplification Conditions
Tm = 60C
Linkage Group
3DL
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09