Query (optional)   in Class  

GrainGenes Probe Report: GPW7090

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW7090
General Remarks
Motif (CCG)58
Type
PCR
SSR
PCR primers
Forward AGAACTCCTCCTGGTCCAGC
Forward AGAACTCCTCCTGGTCCAGC
Reverse ATTGAGCATTCACGGATGGT
Reverse ATTGAGCATTCACGGATGGT
SSR size
Expected 214
Amplification Conditions
Tm = 60C
Linkage Group
(3B)
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09