Query (optional)   in Class  

GrainGenes Probe Report: GPW7101

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW7101  [ Marker Report ]
Locus
Xgpw7101-2A
General Remarks
Motif (CTG)14
Type
PCR
SSR
PCR primers
Forward CCTGGTATGTATGGTAGAGCCC
Forward CCTGGTATGTATGGTAGAGCCC
Reverse ACCGCAGTGGCTGAAATC
Reverse ACCGCAGTGGCTGAAATC
SSR size
Expected 145
Amplification Conditions
Tm = 60C
Linkage Group
2D/2A
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09