Query (optional)   in Class  

GrainGenes Probe Report: GPW7105

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW7105
General Remarks
Motif (GA)17
Type
PCR
SSR
PCR primers
Forward CCAAGAAAGCAAAATTCCCA
Forward CCAAGAAAGCAAAATTCCCA
Reverse GCTGCCCCATCTATGTCG
Reverse GCTGCCCCATCTATGTCG
SSR size
Expected 106
Amplification Conditions
Tm = 60C
Linkage Group
unlinked
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09