Query (optional)   in Class  

GrainGenes Probe Report: GPW7107

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW7107  [ Marker Report ]
Locus
Xgpw7107-5D
General Remarks
Motif (CATG)11
Type
PCR
SSR
PCR primers
Forward GAGAACCTCTACGGAGGCG
Forward GAGAACCTCTACGGAGGCG
Reverse CACTTTGGTCATCCCAGCTT
Reverse CACTTTGGTCATCCCAGCTT
SSR size
Expected 367
Amplification Conditions
Tm = 60C
Linkage Group
5D
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09