Query (optional)   in Class  

GrainGenes Probe Report: GPW7109

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW7109  [ Marker Report ]
Locus
Xgpw7109-1D
General Remarks
Motif (GT)8
Type
PCR
SSR
PCR primers
Forward ATTCGACAACTTCGGGGAG
Forward ATTCGACAACTTCGGGGAG
Reverse TGCAACGCAAACACTACACA
Reverse TGCAACGCAAACACTACACA
SSR size
Expected 281
Amplification Conditions
Tm = 60C
Linkage Group
1D
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09