Query (optional)   in Class  

GrainGenes Probe Report: GPW7111

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW7111
General Remarks
Motif (TGG)8
Type
PCR
SSR
PCR primers
Forward CTTCTGGCTACGAGTAGTACGCT
Forward CTTCTGGCTACGAGTAGTACGCT
Reverse TCTTGTTCTCGATCCGCTTC
Reverse TCTTGTTCTCGATCCGCTTC
SSR size
Expected 152
Amplification Conditions
Tm = 60C
Linkage Group
7A/7B
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09