Query (optional)   in Class  

GrainGenes Probe Report: GPW7113

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW7113
General Remarks
Motif (CAGG)5
Type
PCR
SSR
PCR primers
Forward CTCCCAGTCCCAAGAGCATA
Forward CTCCCAGTCCCAAGAGCATA
Reverse CCAGGACATTACGACGGC
Reverse CCAGGACATTACGACGGC
SSR size
Expected 150
Amplification Conditions
Tm = 60C
Linkage Group
(1D or 2D)
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09