Query (optional)   in Class  

GrainGenes Probe Report: GPW7117

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW7117
General Remarks
Motif (GAAAA)6
Type
PCR
SSR
PCR primers
Forward TCATGTACGGCTTCATCCAA
Forward TCATGTACGGCTTCATCCAA
Reverse CAGCAGCACCAACATCAGATT
Reverse CAGCAGCACCAACATCAGATT
SSR size
Expected 211
Amplification Conditions
Tm = 60C
Linkage Group
3A/3D
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09