Query (optional)   in Class  

GrainGenes Probe Report: GPW7121

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW7121
General Remarks
Motif (CGG)10
Type
PCR
SSR
PCR primers
Forward ATCGAATCGGTAATGGAGCAC
Forward ATCGAATCGGTAATGGAGCAC
Reverse CCACCATGTCGTTGTCGTC
Reverse CCACCATGTCGTTGTCGTC
SSR size
Expected 247
Amplification Conditions
Tm = 60C
Linkage Group
2AL/2B/2D (5D)
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09