Query (optional)   in Class  

GrainGenes Probe Report: GPW7127

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW7127
General Remarks
Motif (GGA)8
Type
PCR
SSR
PCR primers
Forward CCCATAACAATGGCAGGC
Forward CCCATAACAATGGCAGGC
Reverse TCCGTCATTAGAACCTTCCG
Reverse TCCGTCATTAGAACCTTCCG
SSR size
Expected 234
Amplification Conditions
Tm = 60C
Linkage Group
1A/1D
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09