Query (optional)   in Class  

GrainGenes Probe Report: GPW7150

Probe
GPW7150
General Remarks
Motif (ATGC)3
Type
PCR
SSR
PCR primers
Forward TTCATTGATCATGCTTTTGGAC
Forward TTCATTGATCATGCTTTTGGAC
Reverse TCTTCGAGACGTTCGTGCAG
Reverse TCTTCGAGACGTTCGTGCAG
SSR size
Expected 204
Amplification Conditions
Tm = 60C
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09