Query (optional)   in Class  

GrainGenes Probe Report: GPW7167

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW7167  [ Marker Report ]
Locus
Xgpw7167-4A
General Remarks
Motif (AGCT)5
Type
PCR
SSR
PCR primers
Forward ATGGCCTCCATCATGACG
Forward ATGGCCTCCATCATGACG
Reverse CGCACTGATCACTCACCTCC
Reverse CGCACTGATCACTCACCTCC
SSR size
Expected 246
Amplification Conditions
Tm = 60C
Linkage Group
4A
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09