Query (optional)   in Class  

GrainGenes Probe Report: GPW7189

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW7189
General Remarks
Motif (CAG)4(GCA)4(ATGGAC)4
Type
PCR
SSR
PCR primers
Forward GGTCGGTTGACATGGATTAC
Forward GGTCGGTTGACATGGATTAC
Reverse CGTATCTGCTCCTCCGTGA
Reverse CGTATCTGCTCCTCCGTGA
SSR size
Expected 205
Amplification Conditions
Tm = 60C
Linkage Group
2AL/2B/2D
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09