Query (optional)   in Class  

GrainGenes Probe Report: GPW7192

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW7192
General Remarks
Motif (GT)12
Type
PCR
SSR
PCR primers
Forward AACGTGCTCAAGATGCTGC
Forward AACGTGCTCAAGATGCTGC
Reverse CGATCCATGCCATATCACAG
Reverse CGATCCATGCCATATCACAG
SSR size
Expected 314
Amplification Conditions
Tm = 60C
Linkage Group
2AL/2B/2D
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09