Query (optional)   in Class  

GrainGenes Probe Report: GPW7194

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW7194
General Remarks
Motif (AG)10(AGGA)3
Type
PCR
SSR
PCR primers
Forward TTCGTCTCGCAGTCTCAAGAT
Forward TTCGTCTCGCAGTCTCAAGAT
Reverse CTCCTCCGCACACTGATTG
Reverse CTCCTCCGCACACTGATTG
SSR size
Expected 110
Amplification Conditions
Tm = 60C
Linkage Group
3D
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09