Query (optional)   in Class  

GrainGenes Probe Report: GPW7204

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW7204
General Remarks
Motif (TTG)9
Type
PCR
SSR
PCR primers
Forward TGCTGTTGAGGAGGCTCTG
Forward TGCTGTTGAGGAGGCTCTG
Reverse CTGGGAACAATGTGACGATG
Reverse CTGGGAACAATGTGACGATG
SSR size
Expected 150
Amplification Conditions
Tm = 60C
Linkage Group
(5A) 5D
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09