Query (optional)   in Class  

GrainGenes Probe Report: GPW7206

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW7206
General Remarks
Motif (GAGAA)4(AAG)5
Type
PCR
SSR
PCR primers
Forward GCACACACAACAGTGGCAGT
Forward GCACACACAACAGTGGCAGT
Reverse CACCGGACGTCTTCTCATCT
Reverse CACCGGACGTCTTCTCATCT
SSR size
Expected 178
Amplification Conditions
Tm = 60C
Linkage Group
3A
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09